kainbu1rntamer kainbu1rntamer

27-02-2016
Business

contestada

The FDA regulates all of the following except:
A. supplements
B. drugs of abuse
C. prescription drugs
D. over-the-counter drugs

Respuesta :

Аноним Аноним

27-02-2016

The FDA does not yet regulate supplements.

Answer Link

kparkslpn77 kparkslpn77

16-12-2020

Answer:

B. Drugs of abuse

Explanation:

Drugs of abuse, they are usually made in Mexico and brought across the border at illegal border crossings.

Answer Link

Otras preguntas

The world’s largest round pizza was set in December 2012 by five Italian chefs. The diameter of this pizza was 131 feet. If this pizza was cut into 50 slices,

which sentence from the novel frankenstein best reflects the story's gothic nature?

Sheryl was diagnosed with bipolarity when she was a teenager. Sheâ€™s hesitant to tell her friends, and tries her best to hide her diagnosis from her coaches, t

whats 1/3-5/6÷5/6 please help asap

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Seventy eight students are separated into groups of 8 for a field trip. How many groups are there? The remaining students form a smaller group of how many stude

the total mass of these litems is 3.25lb one item is 2 lb. write a possible mass for each other item

Explain why Muslims found it fairly easy to expand their empire throughout the East. Why did non-Christians in the East view the Muslims as liberators?

____________ has the highest per capita GDP in the region. A. Ethiopia c. Somalia b. Kenya d. Sudan

what is 2+5(3+1)-6×30+1