What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Question

30-11-2018
Biology

contestada

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Respuesta :

Otras preguntas

Vladimir, a basketball novice, makes about 60 percent of his free throws when practicing alone. However, when playing with his friends, he only makes about 30 p

Please answer this correctly

What should be changed to make the following sentence true? ""The stress model suggests that people with a predisposition for a disorder are more likely to deve

The Pérez family has 3 children and each son has 3 sisters. How many sons and daughters have at least the Pérez?

A client is admitted to the emergency department with reports right lower quadrant pain. Blood specimens are drawn and sent to the laboratory. Which laboratory

The great migration of the 20th century could best be described as

A sled having a certain initial speed on a horizontal surface comes to rest after traveling 10 m. If the coefficient of kinetic friction between the object and

Reasons for acquiring hostages include publicity, use as a bargaining chip while executing other crimes, the forcing of political concessions, and ransom. a) tr

how did guerrilla warfare contribute to the american victory during the american revolution

ar0282673pdsamx ar0282673pdsamx · Answer 1 · 2021-01-15T21:31:42+01:00

ar0282673pdsamx ar0282673pdsamx

15-01-2021

In biology, specifically in terms of genetics and DNA, complementary means that the polynucleotide strand paired with the second polynucleotide strand has a nitrogenous base sequence that is the reverse complement, or the pair, of the other strand.

Answer Link