Respuesta :

If strand of DNA has the sequence 3' TAGCATCTAC 5', the sequence of on the complementary strand of DNA would be 5'-3'.

Complementary base pairs check with the nitrogenous bases adenine, thymine, cytosine, and guanine. in a double strand of DNA, adenine will usually pair with its supplement thymine and cytosine will usually pair with its supplement guanine.

Elongation of the DNA strand usually proceeds withinside the 5'→ 3' route. This manner new nucleotides are delivered to the 3' cease of the developing strand. So, the collection of the complimentary strand in 5' to 3' route is 5'- GCATGCATGCATGCATGCATGCATGCAT− 3'.

Read more about DNA :

https://brainly.com/question/16099437

#SPJ4