JasmyneR346883 JasmyneR346883

26-10-2022
Mathematics

contestada

For f(x) - 4x +1 and g(x) -7° -5, findStina (1)8(x).4x+1O A.**tv5B.x2-54x +1C.4x +1R-5D.x²-5.4x +1---

For fx 4x 1 and gx 7 5 findStina 18x4x1O Atv5Bx254x 1C4x 1R5Dx54x 1 class=

Respuesta :

AdaleiaX12139 AdaleiaX12139

26-10-2022

From the information given we will have the following:

[tex]\begin{cases}f(x)=4x+1 \\ \\ g(x)=x^2-5\end{cases}\Rightarrow(\frac{g}{f})(x)=\frac{x^2-5}{4x+1};x\ne\frac{1}{4}[/tex]

[Option D]

Answer Link

Otras preguntas

By understanding the competency gaps that are generally perceived by employers, you should Multiple Choice be motivated to learn. seek high levels of achievemen

14 14) Write an expression for the perimeter of a rectangular room with sides x + 4 and 2x - 3 f A) 3x + 7 C) 6x + 2 B) 3x + 1 D) 6x + 12

Find the allowable height for the hypotenuse if the hypotenuse catheters are 4 cm and 9 cm

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Someone help me please!

According to the graph, approximately how much of the us population used the internet in 2006? less than 20% about 40% about 70% more than 80%.

on the tenth day of christmas, what does my true love give to me?

Which correctly identifies the government roles?President= Head of U.S. governmentVice President= Represents states’ peopleU.S. Senator and Representative= Pres

Pete is thinking of skipping car insurance for the first year while he gets adjusted to car payments. Why is this a bad decision

The two team captains agree to eliminate the halftime interval but one of the players insists on a halftime interval. What decision should the referee make