svictorelli svictorelli

31-03-2020
Mathematics

contestada

gift wrapping boxes in the shape of an oblique rectangular prism if e.g. equals 10 FD equals 15 inches CH equals 8 inches in a F equals 10 inches what is the height of the prism

Respuesta :

Justin6646546564 Justin6646546564

01-04-2020

Answer:1. Is 8 2. is 75 3.600

Step-by-step explanation:

Answer Link

JustPrice JustPrice

22-04-2020

Answer:

8 75 600

Step-by-step explanation:

on edge

Answer Link

Otras preguntas

Which country is labeled with the letter "C"?

HELP ASAP PLEASE!!! Which best explains why DNA replication in the human body is significant? 1 it is needed for cell division 2 it replaces any damaged DNA cel

5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.

How did technological developments take place in the Song Dynasty?

Which statements about geologic time are true? Check all that apply. Scientists developed the geologic time scale as they studied rock layers and index fossils

How were the Ottoman Turks different from other rulers in the Middle East? A. They expelled all Jewish people. B. They were tolerant of other religions. C. They

One effect of Latin upon Old English syntax was the reliance upon word endings rather than word order. True False

The volume of a cube is given by and the total surface area of a cube is given by , where s is the side length of the cube. If the side length of a cube is 5 in

Define what it means to be a hybrid plant

The horizontal cross-sectional shapes of the prism given below are all congruent. A. True B. False