Michaelyork1057 Michaelyork1057

28-03-2024
Social Studies

contestada

Eva has a habit of sneaking information as people type out their passwords.
Which technique does Eva use to get passwords?
A. Social engineering
B. Dumpster diving
C. Snagging
D. Shoulder surfing

Respuesta :

Otras preguntas

The walls of a square storage room anywhere else or 300 feet long what is the distance from one corner to the other corner of the storage room

Whenever he was fortunate as to have near him a hare that had been kept too long, or a meat pie made with rancid butter, he forged himself with such violence th

Sally had 13 candy bars she ate 3. How many candy bars does sally have now?

Do all controls go into the controlled substance monitoring database or just CII?

Induction of panic attacks in patients with panic disorder can occur with ________. 1) Carbon dioxide 2) Cholecystokinin 3) Doxapram 4) Yohimbine 5) All of the

13. Area = Is the circle is 6 ft then what is the area?

Which report summarizes what a company owes and owns on a particular date? o Statement of Cash Flows o Balance Sheet o Accounts Payable Report o Profit and Loss

A health cloud administrator receives an error message when trying to access the utilization management app. Which permission sets should the health cloud admin

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT

Given f(x) = 3x - 4, find f(4).a. 8b. 10c. 12d. 14