contestada

16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form • Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe